YSD-C-2u and pYSD-N-2u are yeast display vectors for scFv display on the surface of yeast strain EBY100. pYSD-C/N-2u displays scFv fused to the C/N terminal of AGA2 through GS linker (Figure 1). The origin of replication 2 micron allows for ~50 copies per cell, which may make yeast colony PCR easier. The scFv display level and binding affinity by pYSD-C and pYSD-C-2u are similar, and slightly better than pYSD-N and pYSD-N-2u (Figure 2 and Table 1). 

Figure 1. Schematic representation of scFv yeast display by pYSD-C-2u and pYSD-N-2u.

Figure 2.  Flow cytometry assay of scFv yeast display by pYSD-C, pYSD-N, pYSD-C-2u, and pYSD-N-2u.

Table 1. Flow cytometry analysis of scFv yeast display by pYSD-C, pYSD-N, pYSD-C-2u, and pYSD-N-2u.

	Geometric Mean
	GFP (display)	APC (binding)	APC/GFP
pYSD-C	1947	1556	0.80
pYSD-C-2u	2087	1652	0.79
pYSD-N	1566	980	0.63
pYSD-N-2u	1927	1236	0.64

Even though constitutive promoter TEF1 used in pYSD-C/N-2u, Galactose medium (Teknova #2S0542) is still required for expression and display. Glucose medium (Teknova #2S0540) is suitable for yeast growth.

Figure 3. The effect of glucose and galactose on antibody display and binding affinity.

Table 2. Specifications of pYSD-C/N-2u.

Application	Yeast surface display
Promoter	TEF1
Bacterial replication origin	ColE1
Yeast replication origin	2 micron
Bacterial selection	Ampicillin
Yeast selection	Tryptophan deficiency
Quantity	20ug each, Lyophilized
Reconstitution	Spin down, add 40ul of nuclease-free water/TE/EB buffer, shaking for 30min at 50°C until completely dissolved. Spin down again.
Amplification	Transformation into NEB stable competent cells (#C3040), maxiprep.
Short-term storage	In nuclease-free water or TE, at 4°C
Long-term storage	Lyophilized DNA at -20°C; E. coli glycerol stock, -80°C

Table 3. Primers for amplification and sequencing of inserts.

pYSD-C-2u Forward	GTTCTCACCCCTCAACAAC
pYSD-C-2u Reverse	CGAGCTAAAAGTACAGTGGG
pYSD-N-2u Forward	CAAAGAATTCCCTACTTCATAC
pYSD-N-2u Reverse	GCATATAGTTGTCAGTTCCTG

Table 4. Package contents

Cat. #	Name	Amount
YD002C	pYSD-C-2u	20ug
YD002N	pYSD-N-2u	20ug

Maps of pYSD-C/N-2u